circad | circRNAs associated with diseases

CircSLC3A2
Gene	SLC3A2	Organism	Human
Genome Locus		Build	hg19
Disease	Hepatocellular Carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink		PMID	30470261
Experimental Method
Sample Type	Tissue and cell lines	Comparison	50 paired HCC and adjacent non-tumor tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TTTTCAGCTACGGGGATGAG Reverse ACCTGAGTGGAGAACCACGA	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Wang, H, Chen, W, Jin, M, Hou, L, Chen, X, Zhang, R, Zhang, J, Zhu, J (2018). CircSLC3A2 functions as an oncogenic factor in hepatocellular carcinoma by sponging miR-490-3p and regulating PPM1F expression. Mol. Cancer, 17, 1:165.